Welcome to the 2025 Pathogen Genomic Epidemiology Canadian Bioinformatics Workshop webpage!
Coming soon!
Postdoctoral Fellow
Dalhousie University and University of Guelph
Burnaby, BC, Canada
Angela McLaughlin is a postdoctoral fellow in Dr. Finlay Maguire’s lab at Dalhousie University, in collaboration with Dr. Zvonimir Poljak at University of Guelph. Her research interests span viral phylogenetics (HIV-1, SARS-CoV-2, and influenza virus), genomic epidemiology, bioinformatics, public health, wildlife surveillance, and statistical/machine learning/mathematical models of pathogen transmission. Her current project aims to predict host specificity of avian influenza virus H5Nx using machine learning models of viral genomic features with phylogenetics-informed cross-validation and hierarchical segment to whole genome ensemble models.
Research Associate, Faculty of Health Sciences
Simon Fraser University
Vancouver, BC, Canada
Emma Griffiths is a research associate at the Centre for Infectious Disease Genomics and One Health (CIDGOH) in the Faculty of Health Sciences at Simon Fraser University in Vancouver, Canada. Her work focuses on developing and implementing ontologies and data standards for public health and food safety genomics to help improve data harmonization and integration. She is a member of the Standards Council of Canada and leads the Public Health Alliance for Genomic Epidemiology (PHA4GE) Data Structures Working Group.
Assistant Professor, Faculty of Computer Science and Department of Community Health & Epidemiology,
Dalhousie University
Halifax, MS, Canada— finlay.maguire@dal.ca, finlaymagui.re
Finlay Maguire is a genomic epidemiologist whose work centers on leveraging data in innovative ways to answer questions related to applied health and social issues. This includes developing bioinformatics methods to more effectively use genomic data to mitigate infectious diseases and broad interdisciplinary collaborations in areas such as refugee healthcare provision and online radicalisation. They are an active contributor to the national and international public health responses to emerging viral zoonoses and antimicrobial resistance, co-chair of the PHA4GE data structures working group, and act as a Pathogenomics Bioinformatics Lead for Sunnybrook’s Shared Hospital Laboratory.
Chief, Bioinformatics, National Microbiology Laboratory
Public Health Agency of Canada
Winnipeg, MB, Canada
Dr. Gary Van Domselaar, PhD (University of Alberta, 2003) is the Chief of the Bioinformatics Section at the National Microbiology Laboratory in Winnipeg Canada and Associate Professor in the Department of Medical Microbiology and Infectious Diseases at the University of Manitoba. Dr. Van Domselaar’s lab develops bioinformatics methods and pipelines to understand, track, and control circulating infectious diseases in Canada and globally. His research and development activities span metagenomics, infectious disease genomic epidemiology, genome annotation, population structure analysis, and microbial genome wide association studies.
Postdoctoral Associate
University of Western Ontario
London, ON, Canada
Idowu is a postdoctoral associate in the Guthrie Lab at the University of Western Ontario. His research focuses on utilizing computational biology to understand transmission patterns, genomic evolution, and antimicrobial resistance of bacterial pathogens. He has been involved in numerous bioinformatics workshops and trainings across Africa and most recently in Canada.
Assistant Professor
University of Western Ontario
London, ON, Canada
Dr. Jennifer Guthrie is a Canada Research Chair in Pathogen Genomics and Bioinformatics and Assistant Professor in the Departments of Microbiology & Immunology and Epidemiology & Biostatistics at Western University; she also serves as an Adjunct Scientist at Public Health Ontario. A genomic epidemiologist by training, in her research Dr. Guthrie uses interdisciplinary approaches combining principles from data science and bioinformatics, and more traditional epidemiology and microbiology methods to further our understanding of disease transmission dynamics, antimicrobial resistance, and epidemiological characteristics of pathogens. Her research involves pathogens of public health importance such as SARS-CoV-2, influenza, Mycobacterium tuberculosis, and methicillin resistant Staphylococcus aureus.
Senior Manager, Digital Research
University Health Network
Toronto, ON, Canada — zhibin@gmail.com
Zhibin Lu is a senior manager at University Health Network Digital. He is responsible for UHN HPC operations and scientific software. He manages two HPC clusters at UHN, including system administration, user management, and maintenance of bioinformatics tools for HPC4health. He is also skilled in Next-Gen sequence data analysis and has developed and maintained bioinformatics pipelines at the Bioinformatics and HPC Core. He is a member of the Digital Research Alliance of Canada Bioinformatics National Team and Scheduling National Team.
MSc Graduate Student Researcher
University of British Columbia
Vancouver, BC, Canada
Charlie is an ontology curator at the Centre for Infectious Disease Genomics and One Health (CIDGOH), focusing on data standards for contextual data of genomic epidemiology, including wastewater surveillance. With five years of experience in data management, specializing in biodiversity and genomics data, she also actively contributes to the Public Health Alliance for Genomic Epidemiology (PHA4GE) and the Global Alliance for Genomics and Health (GA4GH).
Coming soon!
Coming soon!
This tutorial aims to introduce a variety of software and concepts related to detecting emerging pathogens from a complex host sample. The provided data and methods are derived from real-world data, but have been modified to either illustrate a specific learning objective or to reduce the complexity of the problem. Contamination and a lack of large and accurate databases render detection of microbial pathogens difficult. As a disclaimer, all results produced from the tools described in this tutorial and others must also be verified with supplementary bioinformatics or wet-laboratory techniques.
### 2. List of software for tutorial and its respective documentation
The workshop machines already have this software installed within a conda environment, but to perform this analysis later on, you can make use of the conda environment located at environment.yml to install the necessary software.
To begin, we will copy over the exercises to ~/workspace. This let’s use view the resulting output files in a web browser.
Commands
cp -r ~/CourseData/module2/module2_workspace/ ~/workspace/
cd ~/workspace/module2_workspace/analysis
When you are finished with these steps you should be inside the directory /home/ubuntu/workspace/module2_workspace/analysis. You can verify this by running the command pwd.
Output after running pwd
/home/ubuntu/workspace/module2_workspace/analysis
You should also have a directory like data/ one directory up from here. To check this, you can run ls ../:
Output after running ls ../
analysis data precomputed-analysis
Next we will activate the conda environment, which will have all the tools needed by this tutorial pre-installed. To do this please run the following:
Commands
conda activate module2-emerging-pathogen
You should see the command-prompt (where you type commands) switch to include (module2-emerging-pathogen) at the beginning, showing you are inside this environment. You should also be able to run one of the commands like kraken2 --version and see output:
Output after running kraken2 --version
Kraken version 2.17.1
Copyright 2013-2023, Derrick Wood (dwood@cs.jhu.edu)
This exercise will produce output files intended to be viewed in a web browser. These should be accessible by going to http://xx.uhn-hpc.ca in your web browser where xx is your particular number (like 01, 02, etc). If you are able to view a list of files and directories, try clicking the link for module2_workspace. This page will be referred to later to view some of our output files. In addition, the link precompuated-analysis will contain all the files we will generate during this lab.
A 41-year-old man was admitted to a hospital 6 days after the onset of disease. He reported fever, chest tightness, unproductive cough, pain and weakness. Preliminary investigations excluded the presence of influenza virus, Chlamydia pneumoniae, Mycoplasma pneumoniae, and other common respiratory pathogens. After 3 days of treatment the patient was admitted to the intensive care unit, and 6 days following admission the patient was transferred to another hospital.
To further investigate the cause of illness, a sample of bronchoalveolar lavage fluid (BALF) was collected from the patient and metatranscriptomic sequencing was performed (that is, the RNA from the sample was sequenced). In this lab, you will examine the metatranscriptomic data using a number of bioinformatics methods and tools to attempt to identify the cause of the illness.
Note: The patient information and data was derived from a real study (shown at the end of the lab).
We will proceed through the following steps to attempt to diagnose the situation.
fastpkatmegahitquast and possible pathogens with blastThe first set of steps follows through an assembly-free approach where we will perform taxonomic classification of the reads without constructing a metagenomics assembly.
#### Step 1: Examine the reads
Let’s first take a moment to examine the reads from the metatranscrimptomic sequencing. Note that for metatranscriptomic sequencing, while we are sequencing the RNA, this was performed by first generating complementary DNA (cDNA) to the RNA and sequencing the cDNA. Hence you will see thymine (T) instead of uracil (U) in the sequence data.
The reads were generated from paired-end sequencing, which means that a particular fragment (of cDNA) was sequenced twice–once from either end (see the Illumina Paired vs. Single-End Reads for some additional details). These pairs of cDNA sequence reads are stored as separate files (named emerging-pathogen-reads_1.fastq.gz and emerging-pathogen-reads_2.fastq.gz). You can see each file by running ls:
Commands
ls ../data
Output
emerging-pathogen-reads_1.fastq.gz emerging-pathogen-reads_2.fastq.gz
We can look at the contents of one of the files by running less (you can look at the other pair of reads too, but it will look very similar):
Commands
less ../data/emerging-pathogen-reads_1.fastq.gz
Output
@SRR10971381.5 5 length=151
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+
!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
@SRR10971381.7 7 length=151
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+
!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
@SRR10971381.33 33 length=115
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+
!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
@SRR10971381.56 56 length=151
CCCGTGTTCGATTGGCATTTCACCCCTATCCACAACTCATCCCAAAGCTTTTCAACGCTCACGAGTTCGGTCCTCCACACAATTTTACCTGTGCTTCAACCTGGCCATGGATAGATCACTACGGTTTCGGGTCTACTATTACTAACTGAAC
+
FFFFFFFAFFFFFFAFFFFFF6FFFFFFFFF/FFFFFFFFFFFF/FFFFFFFFFFFFFFFFFAFFFFFFFFFFFAFFFFF/FFAF/FAFFFFFFFFFAFFFF/FFFFFFFFFFF/F=FF/FFFFA6FAFFFFF//FFAFFFFFFAFFFFFF
These reads are in the FASTQ, which stores a single read as a block of 4 lines: identifier, sequence, + (separator), quality scores. In this file, we can see a lot of lines with NNN... for the sequence letters, which means that these portions of the read are not determined. We will remove some of these undetermined (and uninformative) reads in the next step.
#### Step 2: Clean and examine quality of the reads
As we saw from looking at the data, reads that come directly off of a sequencer may be of variable quality which might impact the downstream analysis. We will use the software fastp to both clean and trim reads (removing poor-quality reads or sequencing adapters) as well as examine the quality of the reads. To do this please run the following (the expected time of this command is shown as # Time: 30 seconds).
Commands
# Time: 30 seconds
fastp --detect_adapter_for_pe --in1 ../data/emerging-pathogen-reads_1.fastq.gz --in2 ../data/emerging-pathogen-reads_2.fastq.gz --out1 cleaned_1.fastq --out2 cleaned_2.fastq
You should see the following as output:
Output
Detecting adapter sequence for read1...
No adapter detected for read1
Detecting adapter sequence for read2...
No adapter detected for read2
[...]
Insert size peak (evaluated by paired-end reads): 150
JSON report: fastp.json
HTML report: fastp.html
fastp --detect_adapter_for_pe --in1 ../data/emerging-pathogen-reads_1.fastq.gz --in2 ../data/emerging-pathogen-reads_2.fastq.gz --out1 cleaned_1.fastq --out2 cleaned_2.fastq
fastp v0.24.0, time used: 17 seconds
You should now be able to nagivate to < http://xx.uhn-hpc.ca/module2_workspace/analysis> and see some of the output files. In particular, you should be able to find fastp.html, which contains a report of the quality of the reads and how many were removed. Please take a look at this report now:
This should show an overview of the quality of the reads before and after filtering with fastp. Using this report, please answer the following questions.
#### Step 3: Host read filtering
The next step is to remove any host reads (in this case Human reads) from our dataset as we are not focused on examining host reads. There are several different tools that can be used to filter out host reads such as Bowtie2 or KAT. In this demonstration, we have selected to run KAT followed by Kraken2, but you could likely accomplish something similar by using Bowtie2 followed by Kraken2.
Command documentation is available here
KAT works by breaking down each read into small fragements of length k, k-mers, and compares them to a k-mer database of the human reference genome. Subsequently, the complete read is either assigned into a matched or unmatched (filtered) file if 10% of the k-mers in the read have been found in the human database.
Let’s run KAT now.
Commands
# Time: 3 minutes
kat filter seq -t 4 -i -o filtered --seq cleaned_1.fastq --seq2 cleaned_2.fastq ~/CourseData/module2/db/kat_db/human_kmers.jf
The arguments for this command are:
filter seq: Specifies that we are running a specific subcommand to filter sequences.-t 4: The number of threads to use (we have 4 CPU cores on these machines so we are using 4 threads).--seq --seq2 arguments to provide corresponding forward and reverse fastq reads (the cleaned reads from fastp)-i: Inverts the filter, that is we wish to output sequences not found in the human kmer database to a file.-o filtered Provide prefix for all files generated by the command. In our case, we will have two output files filtered.in.R1.fastq and filetered.in.R2.fastq.~/CourseData/module2/db/kat_db/human_kmers.jf the human k-mer database we’re using made with jellyfish.As the command is running you should see the following output on your screen:
Output
Kmer Analysis Toolkit (KAT) V2.4.2
Running KAT in filter sequence mode
-----------------------------------
Loading hashes into memory... done. Time taken: 40.7s
Filtering sequences ...
Processed 100000 pairs
Processed 200000 pairs
[...]
Finished filtering. Time taken: 130.5s
Found 1127908 / 1306231 to keep
KAT filter seq completed.
Total runtime: 182.8s
If the command was successful, your current directory should contain two new files:
filtered.in.R1.fastqfiltered.in.R2.fastqThese are the set of reads minus any reads that matched the human genome. The message Found 1127908 / 1306231 to keep tells us how many read-pairs were kept (the number in the filtered.in.*.fastq files) vs. the total number of read-pairs.
#### Step 4: Classify reads using Kraken2 database
Now that we have most, if not all, host reads filtered out, it’s time to classify the remaining reads to identify the likely taxonomic category they belong to.
Database selection is one of the most crucial parts of running Kraken. One of the many factors that must be considered is the computational resources available. Our current AWS image for the course has only 16G of memory. A major disadvantage of Kraken2 is that it loads the entire database into memory. With the standard viral, bacterial, and archael database on the order of 50 GB we would be unable to run the full database on the course machine. To help mitigate this, Kraken2 allows reduced databases to be constructed, which will still give reasonable results but we may end up with more reads unclassified or classified at a higher taxonomic rank. We have constructed our own smaller Kraken2 database using only bacterial, human, and viral data. We will be using this database.
Lets run the following command in our current directory to classify our reads against the Kraken2 database.
Commands
# Time: 1 minute
kraken2 --db ~/CourseData/module2/db/kraken2_db --threads 4 --paired --output kraken_out.txt --report kraken_report.txt --unclassified-out kraken2_unclassified#.fastq filtered.in.R1.fastq filtered.in.R2.fastq
This should produce output similar to below:
Output
Loading database information... done.
1127908 sequences (315.54 Mbp) processed in 5.332s (12693.3 Kseq/m, 3551.00 Mbp/m).
880599 sequences classified (78.07%)
247309 sequences unclassified (21.93%)
kraken_report.txtLet’s examine the text-based report of Kraken2:
Commands
less kraken_report.txt
This should produce output similar to the following:
21.93 247309 247309 U 0 unclassified
78.07 880599 30 R 1 root
78.01 879899 124 R1 131567 cellular organisms
76.37 861411 19285 D 2 Bacteria
56.53 637572 2 D1 1783270 FCB group
56.53 637558 1571 D2 68336 Bacteroidetes/Chlorobi group
56.39 635982 1901 P 976 Bacteroidetes
55.10 621496 35 C 200643 Bacteroidia
55.09 621417 19584 O 171549 Bacteroidales
53.18 599872 2464 F 171552 Prevotellaceae
52.96 597396 397538 G 838 Prevotella
4.74 53473 53473 S 28137 Prevotella veroralis
4.34 48940 48940 S 1177574 Prevotella jejuni
2.56 28880 470 G1 2638335 unclassified Prevotella
This will show the top taxonomic ranks (right-most column) as well as the percent and number of reads that fall into these categories (left-most columns). For example:
21.93 247309 247309 U 0 unclassified shows us that 247309 (21.93%) of the reads processed by Kraken2 are unclassified (remember we only used a database containing bacterial, viral, and human representatives).76.37 861411 19285 D 2 Bacteria tells us that 861411 (76.37%) of our reads fall into the Bacteria domain (the D in the fourth column is the taxonomic rank, Domain). The number 19285 tells us that 19285 of the reads are assigned directly to the Bacteria domain but cannot be assigned to any lower taxonomic rank (they match with too many diverse types of bacteria).More details about how to read this report can be found at https://github.com/DerrickWood/kraken2/wiki/Manual#sample-report-output-format. In the next step we will represent this data visually as a multi-layered pie chart.
kraken_out.txtLet’s also take a look at kraken_out.txt. This file contains the kraken2 results, but divided up into a classification for every read.
Commands
column -s$'\t' -t kraken_out.txt | less -S
column formats a text file (kraken_out.txt) into multiple columns according to a tab delimiter character (flag -s'$\t') and produces a table (flag -t).
Output
C SRR10971381.56 29465 151|151 0:40 909932:2 0:8 909932:2 0:20 29465:4 0:7 178327>
C SRR10971381.97 838 122|122 0:44 2:5 0:23 838:1 0:10 838:2 0:3 |:| 0:3 838:2 0>
C SRR10971381.126 9606 109|109 0:2 9606:5 0:7 9606:1 0:12 9606:1 0:47 |:| 0:47 96>
C SRR10971381.135 838 151|151 0:95 838:3 0:19 |:| 0:15 838:1 0:12 838:5 0:6 838:>
C SRR10971381.219 1177574 151|151 0:11 838:3 0:5 838:2 0:9 838:5 0:11 838:1 976:5 83>
C SRR10971381.223 838 151|151 0:117 |:| 0:61 838:4 0:40 838:1 0:11
[...]
This shows us a taxonomic classification for every read (one read per line). For example:
C SRR10971381.56 29465 tells us that this read with identifier SRR10971381.56 is classified C (matches to something in the Kraken2 database) and matches to the taxonomic category 29465, which is the NCBI taxonomy identifer. In this case 29465 corresponds to the Veillonella.More information on interpreting this file can be found at https://github.com/DerrickWood/kraken2/wiki/Manual#standard-kraken-output-format.
#### Step 5: Generate an interactive html-based report using Pavian
Instead of reading text-based files like above, we can visualize this information using Pavian, which can be used to construct an interactive summary and visualization of metagenomics data. Pavian supports a number of metagenomics analysis software outputs, including Kraken/Kraken2. To visualize the Kraken2 output we just generated, we can upload the kraken_report.txt file to the web application. Please do this now using the following steps:
Download the kraken_report.txt to your local machine from http://xx.uhn-hpc.ca/module2_workspace/analysis (you can right-click and select Save as… on the file).
Visit the Pavian website and click on Upload files > Browse… and select the file kraken_report.txt we just downloaded.
Select Generate HTML report … to generate the Pavian report.
Open the generated report HTML file in your web browser.
If all the steps are completed successfully then the report you should see should look like the following:
#### Step 6: Metatranscriptomic assembly
In order to investigate the data further we will assemble the metatranscriptome using the software MEGAHIT. What this will do is integrate all the read data together to attempt to produce the longest set of contiguous sequences possible (contigs). To do this please run the following:
Commands
# Time: 6 minutes
megahit -t 4 -1 filtered.in.R1.fastq -2 filtered.in.R2.fastq -o megahit_out
If everything is working you should expect to see the following as output:
Output
2025-11-19 15:45:30 - MEGAHIT v1.2.9
2025-11-19 15:45:30 - Using megahit_core with POPCNT and BMI2 support
2025-11-19 15:45:30 - Convert reads to binary library
2025-11-19 15:45:31 - b'INFO sequence/io/sequence_lib.cpp : 75 - Lib 0 (/media/cbwdata/workspace/module2_workspace/analysis/filtered.in.R1.fastq,/media/cbwdata/workspace/module2_workspace/analysis/filtered.in.R2.fastq): pe, 2255816 reads, 151 max length'
2025-11-19 15:45:32 - b'INFO utils/utils.h : 152 - Real: 1.3294\tuser: 1.2124\tsys: 0.3011\tmaxrss: 166748'
2025-11-19 15:45:32 - k-max reset to: 141
2025-11-19 15:45:32 - Start assembly. Number of CPU threads 4
2025-11-19 15:45:32 - k list: 21,29,39,59,79,99,119,141
2025-11-19 15:45:32 - Memory used: 14741121024
2025-11-19 15:45:32 - Extract solid (k+1)-mers for k = 21
[...]
2025-11-19 15:49:08 - Assemble contigs from SdBG for k = 141
2025-11-19 15:49:09 - Merging to output final contigs
2025-11-19 15:49:09 - 3112 contigs, total 1536607 bp, min 203 bp, max 29867 bp, avg 493 bp, N50 463 bp
2025-11-19 15:49:09 - ALL DONE. Time elapsed: 218.408143 seconds
Once everything is completed, you will have a directory megahit_out/ with the output. Let’s take a look at this now:
Commands
ls megahit_out/
Output
checkpoints.txt done final.contigs.fa intermediate_contigs log options.json
It’s specifically the final.contigs.fa file that contains our metatranscriptome assembly. This will contain the largest contiguous sequences MEGAHIT was able to construct from the sequence reads. We can look at the contents with the command head (head prints the first 10 lines of a file):
Commands
head megahit_out/final.contigs.fa
Output
>k141_0 flag=1 multi=3.0000 len=312
ATACTGATCTTAGAAAGCTTAGATTTCATCTTTTCAATTGGTGTATCGAATTTAGATACAAATTTAGCTAAGGATTTAGACATTTCAGCTTTATCTACAGTAGAGTATACTTTAATATCTTGAAGTACACCAGTTACTTTAGACTTAATCAAAATTTTACCCAAATCATTAACTAGATCTTTAGAATCAGAATTCTTTTCTACCATTTTAGCGATGATATCTGTTGCATCTTGATCTTCAAATGAAGATCTATATGACATGATAGTTTGACCTTCTTGTAGTTGAGATCCAACTTCTAAACATTCGATGTCT
>k141_785 flag=1 multi=6.0000 len=355
TATAGAGATAGGTGATAAGGTTTTCCTAGGCGCACAATCAGGTGTACCTGGAAGTTTGAAGGCTAATCAACAACTGATTGGTACACCTCCAATGGAGCAACGCTCTTACTTTAAGTCGCAAGCCATCTTCCGCAGACTGCCTGAGATGTACAAGCAACTAAGCGACTTGCAGAAAGAAATAGACCAATTGAAAAAGAACAGATAACATTCATGGATACAATAAAACAGAAGACATTAAAAGGGAGTTTCTCGCTCTTTGGCAAGGGACTTCACACAGGTTTGAGTCTTACCGTGACGTTTAATCCGGCTCCAGAGAATACTGGCTATAAGATACAACGTATAGATCTTGAGGGGC
[...]
It can be a bit difficult to get an overall idea of what is in this file, so in the next step we will use the software Quast to summarize the assembly information.
#### Step 7: Evaluate assembly with Quast
Quast can be used to provide summary statistics on the output of assembly software. Quast will take as input an assembled genome or metagenome (a FASTA file of different sequences) and will produce HTML and PDF reports. We will run Quast on our data by running the following command:
Commands
# Time: 2 seconds
quast -t 4 megahit_out/final.contigs.fa
You should expect to see the following as output:
Output
/home/ubuntu/.conda/envs/module2-emerging-pathogen/bin/quast -t 4 megahit_out/final.contigs.fa
Version: 5.3.0
System information:
OS: Linux-6.14.0-1016-aws-x86_64-with-glibc2.39 (linux_64)
Python version: 3.9.23
CPUs number: 4
Started: 2025-11-19 15:50:27
[...]
Finished: 2025-11-19 15:50:28
Elapsed time: 0:00:01.273336
NOTICEs: 1; WARNINGs: 0; non-fatal ERRORs: 0
Thank you for using QUAST!
Quast writes it’s output to a directory quast_results/, which includes HTML and PDF reports. We can view this using a web browser by navigating to http://xx.uhn-hpc.ca/module2_workspace/analysis/ and clicking on quast_results then latest then icarus.html. From here, click on Contig size viewer. You should see the following:
This shows the length of each contig in the megahit_out/final.contigs.fa file, sorted by size.
(If it is having issues you can also see the needed information in the pdf report)
#### Step 8: Use BLAST to look for existing organisms
In order to get a better handle on what the identity of the largest contigs could be, let’s use BLAST to compare to a database of existing viruses. Please run the following:
Commands
# Time: 1 second
seqkit sort --by-length --reverse megahit_out/final.contigs.fa | seqkit head -n 50 > contigs-50.fa
blastn -db ~/CourseData/module2/db/blast_db/ref_viruses_rep_genomes_modified -query contigs-50.fa -html -out blast_results.html
As output you should see something like (blastn won’t print any output):
Output
[INFO] read sequences ...
[INFO] 3112 sequences loaded
[INFO] sorting ...
[INFO] output ...
Here, we first use seqkit to sort all contigs by length with the largest ones first (seqkit sort --by-length --reverse ...) and we then extract only the top 50 longest contigs (seqkit head -n 50) and write these to a file contigs-50.fa (> contigs-50.fa).
Note that the pipe | character will take the output of one command (seqkit sort --by-length ..., which sorts sequences in the file by length) and forward it into the input of another command (seqkit head -n 50, which takes only the first 50 sequences from the file). The greater-than symbol > takes the output of one command seqkit head ... and writes it to a file (named contigs-50.fa).
The next command will run BLAST on these top 50 longest contigs using a pre-computed database of viral genomes (blastn -db ~/CourseData/module2/db/blast_db/ref_viruses_rep_genomes_modified -query contigs-50.fa ...). The -html -out blast_results.html tells BLAST to write its results as an HTML file.
To view these results, please browse to http://xx.uhn-hpc.ca/module2_workspace/analysis/blast_results.html to view the ouptut blast_results.html file. This should look something like below:
What is the closest match for the longest contig you find in your data? What is the percent identify for this match (the value Z in Identities = X/Y (Z%)). Recall that if a pathogen is an emerging/novel pathogen then you may not get a perfect match to any existing organisms.
Using the BLAST report alongside all other information we’ve gathered, what can you say about what pathogen may be causing the patient’s symptoms?
It can be difficult to examine all the contigs/BLAST matches at once with the standard BLAST report (which shows the full alignment). We can modify the BLAST command to output a tab-separated file, with one BLAST HSP (a high-scoring segment pair) per line. To do this please run the following:
Commands
blastn -db ~/CourseData/module2/db/blast_db/ref_viruses_rep_genomes_modified -query contigs-50.fa -outfmt '7 qseqid length slen pident sseqid stitle' -out blast_report.tsv
This should construct a tabular BLAST report with the columns labeled like query id, alignment length, subject length, % identity, subject id, subject title. Taking a look at the file blast_report.tsv, what are all the different BLAST matches you can find (the different values for subject title)? How do they compare in terms of % identity and alignment length (in general, higher values for both of these should be better matches)?
Congratulations, you’ve finished this lab. As a final check on your results, you can use NCBI’s online tool to perform a BLAST on our top 50 contigs to see what matches to the contigs.
The source of the data and patient background information can be found at https://doi.org/10.1038/s41586-020-2008-3 (clicking this link will reveal what the illness is). The only modification made to the original metatranscriptomic reads was to reduce them to 10% of the orginal file size.
While we used MEGAHIT to perform the assembly, there are a number of other more recent assemblers that may be useful. In particular, the SPAdes suite of tools (such as metaviralspades or rnaspades) may be useful to look into for this sort of data analysis.
As a final note, NCBI also performs taxonomic analysis using their own software and you can actually view these using Krona directly from NCBI. Please click here and go to the Analysis tab for NCBI’s taxonomic analysis of this sequence data (clicking this link will reveal what the illness is).
The scope of this practical session is to perform a core-genome multi-locus sequence typing (cgMLST) analysis, a genome-based molecular typing method widely adopted for genomic surveillance of bacterial species.
Due to the widespread adoption of high-throughput whole-genome sequencing (WGS) and the advancement of this technology, it has been incorporated in many surveillance programs such as PulseNet Canada to monitor foodborne outbreaks.
This practical is split into two sessions:
In this exercise, you will begin by generating cgMLST allele calls for a collection of 200 Staphylococcus aureus genomes (50 complete and 150 draft genomes) from NCBI RefSeq and BVBRC.
Before we begin, the software we need to conduct our analysis have already been installed on your instance using Conda. However, we need to activate this environment to use the necessary tools.
# Activate conda environment to use chewBBACA and Prodigal
conda activate chewie
ChewBBACA requires a training file to predict genes and proteins for our species of interest. For this purpose, we are going to use the S. aureus USA300 reference genome to generate the training file.
prodigal -i USA300ref.fasta -t Staphylococcus_aureus.trn -p single
Now that we have our training file, we will start by creating a whole-genome multi-locus sequence typing (wgMLST) schema based on the complete 50 S. aureus genomes from NCBI RefSeq
chewBBACA.py CreateSchema -i genomes/NCBI-RefSeq-50 -o mrsa_schema --ptf Staphylococcus_aureus.trn --cpu 4
This will use the prodigal training file to identify CDS from the complete set of S. aureus genomes in NCBI and save them in the mrsa_schema folder
The schema seed will be found in that folder with 3,389 identified loci.
Next is to perform allele calling with the wgMLST schema that we created in the previous step.
This will determine the allelic profiles of the strains we are analyzing by identifying novel alleles, which will be added to the schema.
chewBBACA.py AlleleCall -i genomes/NCBI-RefSeq-50 -g mrsa_schema/schema_seed -o wgMLST_50 --cpu 4
Using a BLAST score ratio (BSR) of 0.6 and clustering similarity of 0.2, 13,762 novel alleles were identified, bringing the number of alleles in the schema to 17,151.
If you noticed from the previous results, 13 paralogs were identified. You can also find them in the paralogous_counts.tsv in the wgMLST_50 folder. It is important to remove these paralogs from the schema due to their uncertainty in allele calls. To do this run the following
chewBBACA.py RemoveGenes -i wgMLST_50/results_alleles.tsv -g wgMLST_50/paralogous_counts.tsv -o wgMLST_50/results_alleles_NoParalogs.tsv
By doing this, the new allelic profile without the paralogs are now saved in
results_alleles_NoParalogs.tsv, which encompasses 3,376 loci
After some QC, we can now determine how many loci are present in the core genome based on the allele calling results. This is based on a given threshold of loci presence in the genomes we analyzed. The ExtractCgMLST module uses 95%, 99%, and 100% to determine the set of loci in the core genome.
chewBBACA.py ExtractCgMLST -i wgMLST_50/results_alleles_NoParalogs.tsv -o wgMLST_50/cgMLST
If you look in the cgMLST folder, there is an interactive HTML line plot showing the cgMLST per threshold relative to the number of loci detected.
From the plot, how many loci are present in the core genome at 95%? We would use this threshold to account for loci that might not be identified due to sequencing coverage and assembly issues.
These are 150 MRSA genomes with good quality from Australia pulled from BVBRC with associated metadata. Mislaballed species have been excluded.
Using the 1,999 loci found in 95% core genomes, we will perfome Allele assignment on the 150 genomes
chewBBACA.py AlleleCall -i genomes/BVBRC-150 -g mrsa_schema/schema_seed --gl wgMLST_50/cgMLST/cgMLSTschema95.txt -o BVBRC-150_results --cpu 4
At the end of the analysis, this added 13,244 novel alleles to the schema with no paralogs
To convert the allelic profiles into a suitable format that can be parsed into other tools, we need to convert the non-integers such as INF, ASM, PLOT3, and PLOT5 into integars
chewBBACA.py ExtractCgMLST -i BVBRC-150_results/results_alleles.tsv -o BVBRC-150_results/cgMLST-150
The purpose of this lab session is to take the cgMLST allele assignment that we have previously generated with chewBBACA and cluster them using Hamming distance matrix and allele thresholds. In addition, we would visualize our dataset using a dendrogram and annotate it with our cluster threshold and associated metadata.
The overall goal is to infer genetic relatedness in our dataset by leveraging computational tools to investigate potential outbreaks and their potential sources.
We will begin by installing the necessary packages and helper script that we need to analyze our data.
Note
Every time you begin a new R session, you must reload all the packages and scripts!
# install packages requiring BiocManager
if (!requireNamespace('BiocManager', quietly = TRUE))
install.packages('BiocManager')
if (!requireNamespace('ComplexHeatmap', quietly = TRUE))
BiocManager::install('ComplexHeatmap')
if (!requireNamespace('treedataverse', quietly = TRUE))
BiocManager::install("YuLab-SMU/treedataverse")
# install other packages
required_packages <- c("tidyverse", "data.table", "BiocManager", "plotly", "ggnewscale", "circlize",
"randomcoloR", "phangorn", "knitr", "purrr", "scales", "remotes","reactable",
"ggtreeExtra")
not_installed <- required_packages[!required_packages %in% installed.packages()[,"Package"]]
if (length(not_installed) > 0) {
install.packages(not_installed, quiet = TRUE)
}
# load packages
suppressPackageStartupMessages(library(tidyverse))
suppressPackageStartupMessages(library(data.table))
suppressPackageStartupMessages(library(treedataverse))
suppressPackageStartupMessages(library(plotly))
suppressPackageStartupMessages(library(ggnewscale))
suppressPackageStartupMessages(library(ComplexHeatmap))
suppressPackageStartupMessages(library(circlize))
suppressPackageStartupMessages(library(randomcoloR))
suppressPackageStartupMessages(library(RColorBrewer))
suppressPackageStartupMessages(library(phangorn))
suppressPackageStartupMessages(library(knitr))
suppressPackageStartupMessages(library(purrr))
suppressPackageStartupMessages(library(scales))
suppressPackageStartupMessages(library(reactable))
suppressPackageStartupMessages(library(ggnewscale))
suppressPackageStartupMessages(library(ggtreeExtra))
## source helper R scripts
source("src/ggtree_helper.R")
source("src/cluster_count_helper.R")
source("src/cluster_helper.R")
source("src/cgmlst_helper.R")
Next read the cgMLST data from chewBBACA and the metadata into memory
# read cgMLST and metadata
aus_mrsa_cgMLST <- read.delim("BVBRC-150_results/cgMLST-150/cgMLST95.tsv", sep = "\t")
mrsa.data <- read.csv("MRSA_AUS_metadata.csv", header = F)
Having loaded our files, we need to make some adjustments to our metadata to make it suitable for our analysis.
first, we are going to change the header, then we are going to create a new column for the host to exclude the taxon ID
# change the header of the metadata file
new.header <- mrsa.data[2,]
aus_mrsa_metadata <- mrsa.data[-c(1,2),]
colnames(aus_mrsa_metadata) <- new.header
head(aus_mrsa_metadata)
aus_mrsa_metadata_reordered <- aus_mrsa_metadata %>%
select(6, everything()) # move 6th column to the first position
head(aus_mrsa_metadata_reordered)
# Create a new Host column with just the host name
aus_mrsa_metadata_reordered <- aus_mrsa_metadata_reordered %>%
mutate(Host = str_remove(`host (common name)`, "\\s*\\[.*\\]"))
Can you spot the differences between the two metadata? Which one do you think we are going to use?
The traditional approach for cgMLST analysis is based on computing pairwise distances between allele profiles as a proxy for the underlying genetic similarity between two isolates. Below, you are introduced to a distance metric called the Hamming distance, which is based on computing the number of differences between a pair of character vectors. The Hamming distance is useful for comparing profiles where a majority of characters are defined, such as profiles comprising core loci.
Given two character vectors of equal lengths, the Hamming distance is the total number of positions in which the two vectors are different:
Profile A: [ 0 , 2 , 0 , 5 , 5 , 0 , 0 , 0 , 0 ]
Profile B: [ 0 , 1 , 0 , 4 , 3 , 0 , 0 , 0 , 0 ]
A != B: [ 0 , 1 , 0 , 1 , 1 , 0 , 0 , 0 , 0 ]
Hamming distance = sum( A != B ) = 3
In phylogenetic analysis, distance-based approaches are rather flexible in the sense that they can be constructed from any measure that estimates genetic similarity through the direct comparison of data points. In cgMLST, we compare allele profiles. In Mash, we compare k-mer profiles.
In the context of two cgMLST profiles, the Hamming distance is calculated based on the number of allele differences across all loci as a proportion of total number of loci evaluated.
Hamming distances will be computed in an all vs. all fashion to generate a pairwise distance matrix that will subsequently serve as the input for distance-based tree-building algorithms. Run the following code chunk:
# use hamming helper function to compute pairwise Hamming distance of cgMLST data
# compute Hamming distance
# PATIENCE!!! this step might take several minutes depending on the size of the dataset
mrsa.dist_mat <- aus_mrsa_cgMLST %>%
column_to_rownames("FILE") %>%
t() %>%
hamming()
# the dimension should be symmetric and should be the size of dataset (i.e. number of QC-passed genomes)
dim(mrsa.dist_mat)
In this section we will be performing hierarchical clustering of the Hamming distance matrix using the Unweighted Pair Group Method with Arithmetic Mean (i.e. UPGMA) algorithm.
Let’s cluster the Hamming distance matrix by running the code chunk below:
# compute hierarchical clustering with hclust function and complete linkage method
mrsa.hc <- mrsa.dist_mat%>%
as.dist() %>%
hclust(method = "complete")
# reorder distance matrix according to the hc order
mrsa.dist_mat <- mrsa.dist_mat[mrsa.hc$order, mrsa.hc$order]
# write reordered distance matrix to files
dir.create("output/clusters", recursive = T)
write.table(mrsa.dist_mat, file = "output/clusters/dist_mat_ordered_cgmlst.tsv",
quote = F, row.names = F, sep = "\t")
Identifying clusters of genomes sharing highly similar cgMLST profiles through the application of distance thresholds is a common practice in genomic surveillance and epidemiological investigations. These genomic clusters can become “analytical units” that can be tracked across space and time:
Identifying cluster membership for every isolate in the dataset at multiple distance thresholds gives us the analytical flexibility to define suitable thresholds for analyzing the pathogen in question. From a practical perspective, a threshold that is too fine-grained will yield a large proportion of the dataset in singleton clusters, making it difficult to link outbreak isolates to one another and to potential outbreak sources. Conversely, using a threshold that is not fine-grained enough will fail to fully exploit the discriminatory power of genomic data, grouping outbreak and non-outbreak isolates indiscriminately.
Adjusting similarity thresholds for cluster membership can be used to tweak the granularity of clusters: higher distance threshold produce larger clusters whereas lower distance thresholds will produce smaller clusters. A threshold of 0 will generate clusters with identical profiles.
For membership at all possible distance thresholds, run the following code chunk:
# Define genomic cluster membership at all possible distance thresholds
mrsa.cgmlst_loci = (ncol(aus_mrsa_cgMLST)-1) ## maximum distance
interval = 1 ## edit interval of interest; currently set to 1 then change to 10 to see how many thresholds are generated
threshld <- seq(0, mrsa.cgmlst_loci,interval)
# extract cluster membership across multiple thresholds
cluster_group <- map(threshld, function(x) {
mrsa.hc %>%
cutree(h = x) %>%
as.factor()
})
# create name for each threshold
names(cluster_group) <- paste0("Threshold_", threshld)
# print clustering results table, no duplicated names are allowed
(
all.clusters <- data.frame(cluster_group ) %>%
rownames_to_column("FILE")
)
# reactable(clusters_all)
# write file of genomic cluster memberships at multiple thresholds
write.table(all.clusters, file = "output/clusters/clusters_all.tsv",
quote = F, row.names = F, sep = "\t")
Questions: How many distinct thresholds are theoretically possible for this dataset? How would you determine the maximum number of allele differences across all genomes in the dataset based on the table above? hint: at some threshold, all genomes collapse to the same cluster…
For membership at select distance thresholds, run the following code chunk:
# Define genomic cluster membership at user-defined distance thresholds
# Can either specify specific thresholds as a numeric vector i.e. c(0, 5, 10, 15)
# If you're feeling lazy, you can also specify using c(seq(5, 100, 5)), which stands for "go from threshold 5 to 100 in
# increments of 5". You can also string multiple notations together within the same numerical vector.
threshld <-c(0, seq(5, 100, 5), seq(200, mrsa.cgmlst_loci, 100)) # currently reads as "use threshold 0,
# then from 5 to 100 in increments of 5
# then from 200 to maximum threshold
# in increments of 100"
# extract cluster membership across multiple thresholds
cluster_group <- map(threshld, function(x) {
mrsa.hc %>%
cutree(h = x) %>%
as.factor()
})
# create name for each threshold
names(cluster_group) <- paste0("Threshold_", threshld)
# print clustering results table, no duplicated names are allowed
(
new_defined_clusters <- data.frame(cluster_group ) %>%
rownames_to_column("FILE")
)
# write file
write.table(new_defined_clusters, file = "output/clusters/new_defined_clusters.tsv",
quote = F, row.names = F, sep = "\t")
Questions: How many user-defined thresholds have we generated in the settings provided here? Which cluster does genome “1280_21738” belong to at a threshold of 25 allele differences? How would you determine how many different clusters were generated at each particular threshold?
A very useful visualization when dealing with distance matrices involves performing clustering, arranging the entries of the matrix based on the clustering order, and displaying the similarity as a heatmap. This produces a heatmap with a distinct 45 degree axis in which clusters of profiles with significant similarity representing possible clades/lineages can be plainly seen as “pockets of heat”. In this section of the lab, we will visualize the distance matrix using the ComplexHeatmap package and we will be comparing these clades to the MLST genotype information on the isolates by overlaying MLST information on the heatmap, which will allow us to examine whether the organism’s MLST is concordant with putative lineages defined by cgMLST similarity as displayed on the clustered heatmap.
Let’s run the code chunk below:
# create column annotations for heatmap
# to display clade information
set.seed(123)
htmap_annot <- aus_mrsa_metadata_reordered$genotype
names(htmap_annot) <-aus_mrsa_metadata$`BV-BRC genome ID`
htmap_annot <- htmap_annot[order(factor(names(htmap_annot),
levels = rownames(mrsa.dist_mat)))]
# create heatmap
mrsa.dist_mat %>%
Heatmap(
name = "cgMLST\nDistance",
show_row_names = F, # do not display row labels
show_column_names = F, # do not display column labels
# use custom color gradient
col = colorRamp2(
c(min(mrsa.dist_mat), mean(mrsa.dist_mat), max(mrsa.dist_mat)),
c("#f76c6a", "#eebd32", "#7ece97")
),
# add column annotation to show MLST info overlaid on the clustered heatmap
top_annotation = HeatmapAnnotation(
MLST= htmap_annot,
col = list(
MLST = structure(brewer.pal(length(unique(htmap_annot)), "Set3"),
names = unique(htmap_annot))
)
)
)
Here you will convert hierarchical clustering result (mrsa.hc) into a dendrogram using the as.phylo() function from the ape package. To visualize the resulting dendrogram, we will use the R package ggtree, which offers an extensive suite of functions to manipulate, visualize, and annotate tree-like data structures. In this section, you will be introduced to some of the different visual capabilities of ggtree and we will progressively update the same tree with several layers of visual annotations based on available metadata.
Note that there is a massive amount of information in the internet dedicated to
ggtreeand all of its capabilities for advanced visualizations. Here we will barely scratch the surface.
Radial vs. Rectangular dendrograms are different ways of visualizing a tree. Radial trees are capable of displaying a lot of simple data in a smaller footprint. In contrast, rectangular trees can display more complex data in a visualization that is easy on the eyes. Rectangular trees rendered as pdf format allow you to really zoom into sub-branches of the tree in greater detail when viewed in a pdf reader or in a browser window. This is essential when you’re dealing with larger datasets comprising hundreds of isolates such as the one we are dealing with here.
Run the following code chunks to:
color_var variable to update the mapping of the color aesthetics in the tree. For example setting color_var = "Host" will color the tree tips by source of isolate.# convert hierarchical clustering to a dendrogram
set.seed(123)
mrsa.cg_tree <- as.phylo(mrsa.hc)
# also, write out the dendrogram to a Newick tree file, can be imported into ITOL or other tree visualization software for manual annotation
dir.create("output/trees", recursive = T)
write.tree(mrsa.cg_tree, file = "output/trees/tree_complete_linkage.newick")
# visualization with a color variable using R ggtree
color_var <- "genotype" # editable variable, currently set to "MLST".
## filter out unknown serotypes to define the number of colors needed for remaining serotypes
n_colors <- length(unique(pull(aus_mrsa_metadata_reordered, !!sym(color_var))))
## create circular dendrogram with variable-colored tippoints
cg_tree_cir <- mrsa.cg_tree %>%
ggtree(layout='circular', # set tree shape
size = 1 # branch width
)%<+% aus_mrsa_metadata_reordered +
geom_tippoint(aes(color = as.factor(!!sym(color_var))),
size = 2,na.rm=TRUE) +
guides(color = guide_legend(title = "MLST", override.aes = list(size = 3) ) ) +
scale_color_manual(values = distinctColorPalette(n_colors),na.value = "grey")
cg_tree_cir
# Create rectangular tree with MLST tip points and text tip labels
# create tip labels
aus_mrsa_metadata_reordered <- aus_mrsa_metadata_reordered %>%
mutate(tip_lab = paste0(Host,"/ ",sample_collection_date))
## plot
set.seed(123)
mrsa.cg_tree %>%
ggtree(layout= "rectangular")%<+% aus_mrsa_metadata_reordered +
geom_tippoint(aes(color = as.factor(!!sym(color_var))),
size = 3,na.rm=TRUE) +
geom_tiplab(aes(label = tip_lab),
offset = 5,
align = TRUE,
linetype = NULL,
size = 3) +theme_tree2()+
geom_treescale(y = 130, x = 0.2) +
guides(color = guide_legend(title = "MLST", override.aes = list(size = 3) ) ) +
scale_color_manual(values = distinctColorPalette(n_colors))
# We save to pdf format
ggsave(file = "output/trees/clade_subtree_rec.pdf", height = 45, width = 40)
Questions: Between ST22 and ST93, which one shows more heterogeneity based on the cgMLST data?
Let’s now superimpose the genomic cluster information on the previous dendrograms (Radial & Rectangular) to examine whether the above code chunk for extracting cluster memberships at various thresholds has generated sensible cluster assignments. Run the code chunk below to insert text labels that span across tree tips assigned to the same clusters at a specified threshold. Interchange your threshold to 50 and 15 and see how it affects your cluster outcome.
You can edit the
target_thresholdvariable to examine how cluster membership changes in response to clustering distance cutoffs.
Run the code chunk below for the radial tree:
# Radial tree visualization
# assign all clusters to clusters for visualization
mrsa.clusters <- all.clusters
target_threshold <- 25 # Editable variable, currently set to a threshold of 25.
aus_mrsa_metadata_reordered <- aus_mrsa_metadata_reordered %>%
select(-tip_lab)
# variable to subset clusters
target_variable <- paste0("Threshold_", target_threshold)
# create cluster group list object
cluster_grp <- mrsa.clusters %>%
select(FILE, target_variable) %>%
group_by(!!sym(target_variable)) %>%
{setNames(group_split(.), group_keys(.)[[1]])} %>%
map(~pull(., FILE))
# sequester singleton clusters
cluster_grp <- cluster_grp[which(map_dbl(cluster_grp, ~length(.)) > 10)]
# create clade group list object
meta2 <- aus_mrsa_metadata_reordered %>%
filter(genotype != "unknown")
Clade_grp <- meta2 %>%
select(`BV-BRC genome ID`, genotype) %>%
split(f = as.factor(.$genotype)) %>%
map(~pull(., `BV-BRC genome ID`))
# add cluster memberships and clade information to tree object
mrsa.cg_tree <- groupOTU(mrsa.cg_tree, cluster_grp, 'Clusters')
mrsa.cg_tree <- groupOTU(mrsa.cg_tree, Clade_grp, 'MLST')
# plot core genome tree where colored blocks = clusters and text annotations = clades
valid_clade_grp <- Clade_grp %>%
keep(~all(.x %in% mrsa.cg_tree$tip.label)) %>%
keep(~length(.x) > 1) # Need at least 2 tips for MRCA
valid_cluster_grp <- cluster_grp %>%
keep(~all(.x %in% mrsa.cg_tree$tip.label)) %>%
keep(~length(.x) > 1)
mlst.t25 <- mrsa.cg_tree %>%
ggtree(layout='circular', # Editable tree shape, currently set to circular?
size = 1 # branch width
) +
# add colored blocks to display clades
geom_hilight(
mapping = aes(
node = node,
fill = MLST,
subset = node %in% map_dbl(
valid_clade_grp,
~getMRCA(mrsa.cg_tree, .)
)
)
) +
#add text annotations to display clusters
geom_cladelab(
mapping = aes(
node = node,
label = Clusters,
subset = node %in% map_dbl(
valid_cluster_grp,
~ getMRCA(mrsa.cg_tree, .)
)
),
horizontal=T,
angle = 'auto',
barsize = 0.75,
offset = 50,
offset.text = 50,
align = T
) +
# legend parameters
guides(fill = guide_legend(
nrow = 11,
override.aes = list(alpha = 0.8)
)
) +
labs(fill = "MLST") +
scale_fill_brewer(palette = "Paired")
mlst.t25
final_plot <- mlst.t25 %<+% aus_mrsa_metadata_reordered +
geom_tippoint(aes(color = Host), size =2) +
scale_colour_manual(name = "Host", values = c("#008080","#ffa500","#00ff00","#0000ff","#ff1493"))
final_plot
Here we can see a couple of things:
ggsave("Threshold25_clusters.pdf", plot = final_plot, height = 10, width = 8, device = "pdf")
Congratulations! You have successfully completed Module 3.
Author: Finlay Maguire
Last Modified: 2025-11-11
Link to PDF of slides from google
In this lab practical we will be using microbial genomes (and associated contextual metadata) to investigate a suspected nosocomial (hospital-acquired) outbreak of Methicillin resistance Staphylococcus aureus (MRSA) in a UK-based Neonatal Intensive Care Unit (NICU). The data we are using comes from a classic study which demonstrated the utility of whole genome sequencing for investigating an MRSA outbreak within a Special Care Baby Unit (also known as a NICU) of the Cambridge University Hospitals NHS Foundation Trust (CUH).
Harris SR, Cartwright EJP, Török ME, et al. Whole-genome sequencing for analysis of an outbreak of methicillin-resistant Staphylococcus aureus: a descriptive study. Lancet Infect Dis 2012 10.1016/S1473-3099(12)70268-2
This practical will step you through the genomic components of a typical nosocomial bacterial outbreak investigation, specifically:
Staphylococcus aureus is a Gram-positive coccoidal bacteria that forms a normal commensal member of the microbiome in 20-40% of people (Karsten, 2017). However, when skin and mucosal barriers are disrupted (e.g., through medical procedures such as catheterisation, tracheal tubes, surgeries) S. aureus can cause opportunistic invasive infections (Lee, 2018).
Since the 1960s, variants have emerged and spread globally that are resistant to the majority of β-lactam antibiotics through the independent acquisitions of the staphylococcal cassette chromosome mec (SCCmec) (IWG-SSC, 2009. This combination of commensal carriage, antimicrobial resistance, and healthcare-associated infection opportunities (along with additional virulence factors) have led to MRSA becoming a leading cause of hospital-associated mortality and morbidity globally (GBD, 2024). Therefore, tracking and preventing MRSA outbreaks is a major priority for infection prevention and control (IPAC or IPC) within hospital settings especially within the NICU due to the vulnerability of immunocompromised preterm infants and the high frequency of invasive procedures. This has led to adoption of genomic epidemiological approaches to detect MRSA outbreaks and track transmission links not apparent from traditional approaches alone (Blane, 2024). These sort of outbreak investigations are generally led by the infection prevention & control (IPAC or IPC) team in a clinical setting or by the relevant public health team depending on the suspected infection source, geographic scale, and regional resource availability (e.g., Public Health Agency of Canada/Canadian Food Inspection Agency or provincial bodies like Public Health Ontario).
Within the SCBU/NICU of Cambridge University Hopitals NHS Trust (and most hospitals) all inpatients are screened for MRSA carriage upon admission and once per week thereafter using culture-based or nucleic-acid based test. Specific IPAC policies and guidelines will determine criteria for initiating an outbreak investigation (e.g., a certain number of positive screens within a specific time and/or location).
Routine surveillance has identified that 3 infants within the SCBU/NICU (P11-P13) are positive for MRSA carriage at the same time. Isolates from these 3 infants have also been shown to have the same pattern of antibiotic resistances. The IPAC team has therefore been activated to further investigate this as a suspected outbreak in the SCBU/NICU at CUH. They have performed a systematic review of all MRSA isolates from the SCBU/NICU over the preceding 6-12 months and identified a series of overlapping MRSA carriages with this same set of resistances. Due to multi-week gaps in the positive SCBU/NICU isolates they have also collected potentially matching MRSA isolates from parents and the wider hospital/community. To gain better insight into this potential outbreak and identify which of these isolates are linked by direct transmission chains, CUH have sequenced these isolates using 150bp paired-end reads via an Illumina MiSeq platform.
You are a clinical bioinformatician who has been asked to support the investigation and analyses these genomes
This lab practical will involve running the following software:
Typically, most of these analyses would be run using a workflow such as bactopia that you are confident will reproducibly generate validated and verified outputs (ideally as part of your institution’s ISO15189 accreditation or equivalent). We will run the tools directly today so you get insight into what these workflows are actually doing!
Using ssh connect to the provided analysis server instance:
ssh -i YOUR_KEY.pem YOUR_USER@XX.uhn-hpc.ca
Now create a folder in your ~/workspace and copy/link over the files you will need:
mkdir -p ~/workspace/module4
cd ~/workspace/module4
cp -r ~/CourseData/module4/contextual_data.csv ~/CourseData/module4/SASCBU26_reference.fna .
ln -s ~/CourseData/module4/assemblies .
Specific collection dates were not available so have been inferred based on relative sampling gaps
When you are finished with these steps you should be inside your work directory ~/workspace/module4. You can verify this by running the command pwd.
s
Output after running pwd
~/workspace/module4
You now see an assemblies/ folder in the current directory along with a contextual_metadata.tsv (all the contextual data needed for this analysis) and SASCBU26_reference.fna (the reference genome we will use later):
Output after running lss
SASCBU26_reference.fna assemblies contextual_data.csv
Next we will activate the pre-installed conda environment, which will have all the tools needed by this tutorial pre-installed. To do this please run the following:
Commands
conda activate outbreak
You should see the command-prompt (where you type commands) switch to include (outbreak) at the beginning, showing you are inside this environment. You should also be able to run the mlst command like mlst --version and see output:
Output after running mlst --version
mlst 2.23.0
Similar to yesterday, we will want to either use the assigned hostname (e.g., xx.uhn-hpc.ca where xx is your instance number) or find the IP address of your machine on AWS so we can access some files from your machine on the web browser. To find your IP address you can run:
Commands
curl http://checkip.amazonaws.com
This should print a number like XX.XX.XX.XX. Once you have your address, try going to http://xx.uhn-hpc.ca or http://IP-ADDRESS and clicking the link for module4. This page will be referred to later to easily download/view some of our output files.
All isolates that are putatively linked to the outbreak have been done so on the basis of time, location, and phenotype (specifically antibiotic susceptibilities). However, just because 2 isolates have the same resistance pattern does not mean they are closely related. Although this is a relatively small set of isolates we are often evaluating very large numbers of genomes for their potential connection to an outbreak. Additionally, most downstream outbreak analyses (such as transmission inference) perform best when applied to as little diversity as possible (i.e., just genomes from a single outbreak event).
This means our first task is to identify and group which isolates are actually connect
are likely to be linked using the sort of typing methods you encountered in the previous lab practical. This helps us to eliminate unrelated genomes and determine whether 1 or more outbreaks are likely to be taking place.
To make things faster for this practical, we have provided pre-inferred genome assemblies (generated using shovill with the skesa assembler).
You can infer the 7-gene MLST using the pubMLST Staphylococcus aureus scheme by running the mlst tool on each of the genome assemblies.
mkdir -p outbreak_cluster_identification; cd outbreak_cluster_identification
mlst --scheme saureus ../assemblies/*.fa > mlst.tsv
Now download the mlst.tsv output file (using either scp or the IP address listed above) and open it in your tabular data tool of choice (e.g., pandas/python, R, excel).
Based on these results, which genomes do you suspect may not be part of this outbreak?
Why might genomes with a different MLST still be closely related or those with the same MLST be relatively unrelated?
MLST are only 7 genes so a small amount of mutation (or conservation!) in just these genes can lead to a totally different MLST - schemes are designed to try and be robust but are mutation is a random process with high variance!
We could solve this challenge using a more fine-grained scheme like cg/wgMLST (as discussed in the previous module) but we are going to use poppunk in this lab.
poppunk is a rapid k-mer based genome clustering tool that groups genomes together based on both their core and accessory genome distances. This allows differential clustering of similar genomes which have acquired novel plasmids and so on.
The developers of poppunk provide some pre-computed databases (although it is relatively easy to create your own) for different species which are available here.
We have already downloaded a reference database for you, so all you have to do is prepare a 2-column file genomes.txt which has a series of names in the first column and the path to the related genome assembly in the other.
We can do this using a quick bash one-line loop:
for i in ../assemblies/*.fa; do isolate=$(echo $i | cut -d '/' -f3 | cut -d '.' -f1); echo -e "$isolate\t$i" >> genomes.txt; done
Then we can run the following to get poppunk cluster assignments:
poppunk_assign --db ~/CourseData/module4/staphylococcus_aureus_v1_full --query genomes.txt --output poppunk
Now download/inspect poppunk/poppunk_clusters.csv file
Which genomes does this analysis suggest should be excluded? Do they match the MLST results?
P27-28 are assigned to cluster 1 and P30-33 are assigned cluster 12. Remaining samples are assigned to cluster 3.
mlst.tsv we
can see that these STs only differ by a single allele (arcC) so could be
linked in the main outbreak.We can’t be sure about cluster 3 without further analysis but we can drop cluster 1 and 12 for now.
Now that we have eliminated some isolates that are unlikely to be connected to our main outbreak we can do a deeper analysis of the evolutionary relationships between our isolates. For this we are going to perform a phylogenetic analysis. There are several way this could be done:
panaroo on the genome assembly annotation files (generated with prokka or bakta).snippy.ska (then using a reference to order these SNPs)For SNP analyses, why might we want use a reference derived from an outbreak isolate instead of standard species reference genome?
We maximise the number of detectable SNPs by using a reference as close as possible to our other genomes
For this lab, we are going to do the last option using a complete high quality reference genome generated from this outbreak subsequent to the original manuscript: SASCBU26
First let’s generate the input file for SKA using the poppunk results
cd ~/workspace/module4; mkdir -p ska_phylogeny; cd ska_phylogeny
paste <(grep "3$" ../outbreak_cluster_identification/poppunk/poppunk_clusters.csv | cut -d, -f1) <(grep "3$" ../outbreak_cluster_identification/poppunk/poppunk_clusters.csv | cut -d, -f1 | perl -ne 'chomp; print "../assemblies/$_.fa\n"' ) > ska_input
echo -e "SASCBU26\t../SASCBU26_reference.fna" >> ska_input
Now we need to generate an SKA index:
ska build -f ska_input -k 31 -o ska_index --threads 4
Then map these split k-mers against the reference (required to order them for the next step):
ska map -o ska.aln --ambig-mask ../SASCBU26_reference.fna ska_index.skf
This gives us an alignment but due the distorting effects of recombination we typically want to try and remove any potential recombinant sites from the alignment. There are several tools that can help us do this (verticall, ClonalFrameML, gubbins) and today we are going to use gubbins.
mkdir -p gubbins
run_gubbins.py --prefix gubbins/gubbins ska.aln
mask_gubbins_aln.py --aln ska.aln --gff gubbins/gubbins.recombination_predictions.gff --out gubbins.masked.aln
Now that we have a masked alignment gubbins.masked.aln we can analyse the SNP network using GraphSNP to further refine our potential outbreak samples. First, generate a SNP distance matrix using snp-dists:
snp-dists gubbins.masked.aln | sed 's/\t/,/g' > raw_outbreak_matrix.csv
Now download the raw_outbreak_matrix.csv, navigate to GraphSNP in your browser, and upload the raw_outbreak_matrix.csv as your Alignment/matrix.
Then click on “Graph” at the top of the page (may be hidden behind 3 horizontal lines on smaller screens), increase your “Cutoff number” to 50, and then hit the “Create Graph” button.
This will create a minimum spanning tree grouped using a 50 SNP cut-off.
Which genomes do you think you can eliminate from being part of these immediate outbreak cluster?
Based on the graph, isolates P29 & P34-P38 can be eliminated.
These were the ST22 isolates identified by mlst that
poppunk convinced us to look at a bit more closely. We can see the
closest is only ~80 SNPs from our outbreak cluster.
Let’s also look at these isolates using a traditional phylogenetic approach. Go back to the server and run the following command to build a maximum-likelihood tree using iqtree:
iqtree -s gubbins.masked.aln
This will generate a lot of outputs but if you download the newick formatted phylogeny gubbins.masked.aln.treefile and go to microreact we can visualise the tree.
Hit the “Upload” button and select your treefile.
Then hit the settings slider icon at the top right
Finally, select radial/unrooted tree.
Does the phylogeny show the same genomes as being outside the main outbreak cluster
Yes, P37 & P38 are close to the main outbreak cluster and could be included but for now we will exclude them.
Now we have refined our final set of suspected outbreak isolates we can create our final alignment of just these sequences.
Create a SNP distance matrix and phylogeny for just the final outbreak isolates by repeating the above steps with a modified ska_input (if you create a new folder you’ll avoid getting mixed up with your new datas).
A pre-computed distance matrix and phylogeny can be copied from
~/CourseData/module4/refined_outbreak_matrix.csv and
~/CourseData/module4/refined.gubbins.masked.aln.treefile
With our refined outbreak distance matrix and phylogeny we are going to perform some transmission analyses by combining these with some of our context data.
First we are going to use the SeqTrack method as implemented in GraphSNP.
To do this download contextual_metadata.csv and your refined distance matrix (e.g., refined_outbreak_matrix.csv or whatever you have named it) and then navigate to GraphSNP.
This time you must upload the new distance matrix under Alignment/matrix and the metadata table under Metadata.
Then navigate to “Graph” but this time select analysis type “transmission” and click “Create Graph”
Which person is inferred to have infected the largest number of other patients?
P8 or P4
Which baby/babies was/were inferred to be infected by a parent?
P13 and P15
Congratulations you’ve performed your first transmission analysis!
The next step would be to try and perform a more sophisticated transmission inference method using TransPhylo.
However, this would require us to infer a time-scaled phylogeny and you’ll discover more about how to do that in the next module!